Today Is National Puppy Day! Let's See Yours - Then and Now!

Watchdog said:
When they were puppies, Annie and Beau argued daily about who's the Top Dog in this house.

No one ever got hurt, no one was seriously bitten...just little nips and some grabbin'-hold-and-shakin' type stuff.

They never really settled the issue, but agreed to continue the discussion for the rest of their lives whenever the mood hits them.

Note: In actuality, though, Annie is Top Dog. Although Beau outweighs her by a good fifty pounds, she will give him a pretend butt whuppin' every now and again. And she will sometimes just look at him out of the blue from a few feet away...giving him that Rottweiler Death Stare and showing her front teeth...and Beau simply can't stand up to that level of intimidation, even though he is fearless at other times. He will just leave the room and won't return until he's sure it's okay or I call him.
Click to expand...


Man, there's some serious dentition showing there!
 
ChattanoogaPhil said:
Thanks. So far so good. Vet gave Shasta the once-over and looks like all is well. Vet said Beagle sumpin'... who knows? Went through her first lightening and thunderstorm last night with flying colors. She looked up at the first flash and boom for a second... then went back to snoozing. Isn't nervous riding in the truck unless the wife is driving (me too) :D

Alert, active, healthy appetite and seems easy going. I think Shasta is going to do well.... though a long way to go in a galaxy far far away from being house trained... yet.

I put my foot down about sleeping in bed. Made it clear to the wife in no uncertain terms this dog was NOT going to sleep in bed. Wife smiled and said anything you say dear. 10 minutes later I picked up Shasta and she snuggled in our bed. Yeah yeah... I know. :rolleyes:
Click to expand...

When my boy was a teen-ager (he's 60 now), we went camping and took along a friend of his. We were going to make it two days and on the second day we would climb Cerro Alto, the mountain that's on the east skyline of El Paso. We also took along our Sheltie, Missy. We camped at the base of the mountain. I made a three shelterhalf tent and we had two sleeping bags for the boys and a couple of blankets for me. It was late October and it turned colder than I thought. Two blankets wern't enough and I was uncomfortable for several hours. Then I turned on the flashlight and saw Missy sitting by the tentpole, cold and miserable. I hauled her into bed with me, tucked her nose outside the blanket and we kept each other warm all night. I don't think either of us moved until morning.

Years before, her first night with us as a tiny puppy, we made a bed for her with a few towels, next to our bed. A couple of times during the ngiht I heard her wimper; I guess she missed her mother and the other puppies from her litter. I put my hand down on her and she went right back to sleep.
 
This is not a then and now because we have only had this dog less than 2 months. It some how got into my daughters yard and her Catahoula tried to kill it. My son in law saved her and after my wife took it to the vet, she decided to keep it. We now have 4 dogs, 3 are rescues. The little dog only weighed 18 lbs, her ribs were sticking out, the edges of her ears were raw and she was scared of everything. She did not make a sound for over a week. One day, she saw the Catahula next to the fence. She got about 15 feet from the fence and howled at her tormentor with that hound dog yell. It got to the point where the 2 dogs would run back and forth by the fence. This photo is just after she was running next to the fence howling at the big dog and then running away. Look at the joy on her face.

daisy%203.jpg
 
Last edited:
Bkreutz said:
We're leaning toward a Schnauzer. (Standard or Toy, not Giant because that would be like putting the fork in the light socket for the third time)[/QUOTE


I had a Giant. The first year was crazy but fun then he "got it" right at a year. After that he was still a big goof but didn't try me so much and seemed to get more attached to me. What a cool dog. I miss him so much.
Click to expand...
 
bruce5781 said:
My puppy will be 7 years old this week.
23564044f3510fd147d987cae6ae4c7a.jpg

Regards,
Bruce
Click to expand...

They grow up so fast, don't they? It's sometimes a mental shock to realize my dogs are seven-years-old because it hits me that I am seven years older, myself.

That's a gorgeous dog. Thanks for the photos.
 
Watchdog said:
They grow up so fast, don't they? It's sometimes a mental shock to realize my dogs are seven-years-old because it hits me that I am seven years older, myself.

That's a gorgeous dog. Thanks for the photos.
Click to expand...
Thank you so much. She's my pride and joy. When she passes, I plan to start adopting senior rescues.

Regards,
Bruce
 
Well... here's what I got for my $80. :rolleyes:

My dog's DNA is:

GTTCCCCGGGGCCAATGCGAAAGAAAGAATCAGGGACAGACGGCCNNAGA
GAAGGGGAATTTTAGTCACTCTCAGAAGGCCGGCCGGAACCGGGGCCCCA
GGGTTAATCTCTTAGGGCCTCAATTGGAGCGTGAAACAAAGCCTGCCGGCC
CCAGAAGGAGTGCGTCTCAAAGTCAGGGAANNTCAACCTTTCCCTCCGGG
TTAGAGCCAAAGTCCCAGAACCTCGGTCACAGAAAAAATATGTCTCTTAGTT
AGTCAGTTAGAAGGAACCAAGGAAAACCGGTTTGAGGGCCGGAGAGAGCC
AAAGTCTTTCTCTAAAAAAATCAATGAATCACTTAATTGGAGTTAGTCGGAAA
GTTCCTCAGTCTCCCAATCAACCTTAGAGTCAGAGAGGGTCAACCGCTCAAA
GAGTGTGAGCCAAACAATCTGAACCAGAGAGTCGGTCAGTCAAGGCCTTTTA
GCCGGTTCCTCCCTTGGAGAGTCTCCCCCTTACGGGGGGAGACCCAGAAGG
AACCAATTAGCCAGTCAGCCGGGGACGGAGTGGGAGACAAAAAGGGCCAGA
GAATTTCTGGGAATTAGAAAGCGCCAAAGGGCCAGGGGGCCCCTTTTTTGGG
CTTTTGGCCTCTCGGAATGACTCAAGGTCGGTCAGTTAATCTCGGTTAACCGG
GGGGAAAGAAGGTTAAAGAAGGCCAAAGAGAGTCAAAACGAGAACCAGAAG
GAAGGCCCCAATGGGTCCCAGAATTGGCCGG

Translated...

25% Beagle
25% Siberian Husky
25% American Staffs
12% Boxer
12% Mix of mixes of three groups.

(Terror)
Chihuahua
Soft-coated Wheaten Terrier
Standard Schnauzer
Russell Terrier
Miniature Pinscher

(Sighthound)
Irish Wolfhound
Italian Greyhound
Whippet
Greyhound

(Companion)
Bichon Frise
Pug
Shih Tzu
Keeshond
Pomeranian

I duknow... looks like a purebred bum to me!
Of everything on the list...
She's nose to the ground like a Beagle.
Coloring/Markings of a Miniature Pinscher
Long legs like a Boxer

 
Last edited:
Watchdog said:
It'll be interesting, I think, to see what size she grows into as she gets older. She's marked similarly to my dogs except for her paws and toenails. I'm betting the brown spots on her ears will go away as she gets older. I can see a bit of Beagle in the shape of her face right now.
Click to expand...

At first I thought she might be slow to housetrain but as it turned out it was less than a week. Almost scary smart. Sits, stays and comes to her name. Tell her to "get yer ball" she'll stop and think for a couple seconds then like a light bulb goes on she goes and gets it. She's equally stubborn when she feels like it. Final shots this week and after that she can go to the dog park and RUN... thank god... she's a bundle of energy. Very proud animal.

8 weeks 6+ pounds.


16 weeks 17 pounds
 
ChattanoogaPhil said:
At first I thought she might be slow to housetrain but as it turned out it was less than a week. Almost scary smart.
Click to expand...

Dogs can be remarkably easy to housetrain. All it takes is the right attitude, patience, and kindness...never scolding, never swatting.

ChattanoogaPhil said:
Sits, stays and comes to her name. Tell her to "get yer ball" she'll stop and think for a couple seconds then like a light bulb goes on she goes and gets it. She's equally stubborn when she feels like it.
Click to expand...

Stubborn...she's testing you. My dogs are fully grown, and they still do it. Dog trainers say it's wrong to do it, but sometimes I let them win their little contests of will. Feed their canine ego, so to speak. I'll let them win the tug o' war sometimes...then they'll strut and prance around like they're the cock of the walk for sure.

ChattanoogaPhil said:
Final shots this week and after that she can go to the dog park and RUN... thank god... she's a bundle of energy. Very proud animal.
Click to expand...

Have you had her microchipped yet? By all means, do so.

8 weeks 6+ pounds.


16 weeks 17 pounds
[/QUOTE]
 
Watchdog said:
Dogs can be remarkably easy to housetrain. All it takes is the right attitude, patience, and kindness...never scolding, never swatting.
Click to expand...

I know there's different and probably better ways, but here's how we did it. After getting her home and on a strict eating schedule, I kept notes of the times she did her thing for a couple days (lots of "mistakes"). After that I pretty much knew the timing of her system and took her outside a bit beforehand. After about three or four days and several "mistakes" she barked at the door! That was that. It was like a child graduating grammar school! :). I was quite surprised. My last dog, Pugsters, was not nearly as quick to housetrain.

Next BIG project is to teach her how to walk without pulling. She's got a lot of Beagle in her and her brain short-circuits outside. We're going to get some professional help with walking.
 
I kept taking my guy out every 2 or 3 hrs. When I was at work he would be in a crate. In about a week he knew when to ask and when to hold it in. While he was a puppy I let him in a crate when I would leave. A little later I would corner of a section for him when I wasn't home. When he stopped having occasional accidents I let him roam free.

All in all it took a week if not less to get him to understand to ask and to hold it in. A few more months to stop having accidents and to make sure

Sent from my XT1650 using Tapatalk
 
ChattanoogaPhil said:
I know there's different and probably better ways, but here's how we did it. After getting her home and on a strict eating schedule, I kept notes of the times she did her thing for a couple days (lots of "mistakes"). After that I pretty much knew the timing of her system and took her outside a bit beforehand. After about three or four days and several "mistakes" she barked at the door! That was that. It was like a child graduating grammar school! :)
Click to expand...

I should have mentioned that puppies do have sort of a "schedule" for going to the bathroom. Usually they'll need to go shortly after eating, and pretty soon after playtime, and soon after waking from a nap. You did good, I think.

At 16 weeks, she's beginning to have more control over her bladder and bowels...younger puppies don't have that control.

As she gets older, it'll gradually begin to take up to eight hours for a stomach full of food to work its way through her digestive system and need to be...eliminated.
 
anoblefox said:
Just picked up this little girl (Nancy) on Sunday to help keep me company; after my loss of Zoey last December (post 46)
attachment.php
Click to expand...

What a beautiful puppy! Just look at those ears already standing up. Looks as if she's ready to go...ready for years and years of fun, companionship, and love. You know I'm sorry for Zoey's loss, but I'm happy for you that you have a new Best Friend now. I never look at new puppies as any sort of replacement for dogs that have left me...just see them as a continuation of the adventure, an extension of ongoing love.
 
You must log in or register to reply here.

Similar threads

J
Boring day today
Replies
9
Views
337
lihpster
lihpster
prairieviper
October 29th is National Cat Day!
2
Replies
35
Views
1K
BLUEDOT37
BLUEDOT37
fordson
National Wright Brothers Day
Replies
8
Views
340
Retired W4
Retired W4
snubbyfan
Today is International Beer Day!
2
Replies
38
Views
847
crows
C
handejector
Merry Christmas to You and Yours!
2
Replies
23
Views
526
CALREB
CALREB

Latest posts

Back
Top